Journal: Cell Reports Medicine

Article Title: Targeted brachyury degradation disrupts a highly specific autoregulatory program controlling chordoma cell identity

doi: 10.1016/j.xcrm.2020.100188

Figure Lengend Snippet:

Article Snippet: HDR Templates ( ) , Twist Bioscience , N/A.

Techniques: Recombinant, Cell Viability Assay, Caspase-Glo Assay, Isolation, SYBR Green Assay, Software, Empire Assay

Journal: Current protocols in human genetics

Article Title: CRISPR/Cas9 Mediated Fluorescent Tagging of Endogenous Proteins in Human Pluripotent Stem Cells

doi: 10.1002/cphg.52

Figure Lengend Snippet: Example schematic for fluorescent reporter HDR template design and integration at a target gene. Here, the fluorescent tag will be placed at the N-terminus of the encoded target protein. A) Representation of the wild type hiPSC sequence. Guide RNA target sequence (shown in red) should target within 30 bp of the mutation start site. M indicates start codon coding for methionine. B) HDR template design schematic. In a 2000 bp gBlock fragment, design the vector as shown. We recommend a glycine-serine linker with amino acid sequence GGGGSGGGGSGGGGS. C) hiPSC sequence after HDR template integration. Primers at the indicated regions can confirm successful eGFP template vector integration.

Article Snippet: Benchling will automatically modify the PAM site in the HDR template so that the selected guide RNA does not self-target the generated HDR template.

Techniques: Sequencing, Mutagenesis, Plasmid Preparation

Journal: Current protocols in human genetics

Article Title: CRISPR/Cas9 Mediated Fluorescent Tagging of Endogenous Proteins in Human Pluripotent Stem Cells

doi: 10.1002/cphg.52

Figure Lengend Snippet: Timeline for nucleofection, subcloning, and expansion of fluorescently-tagged hiPSCs. Assume a daily mTeSR1 media change for all hiPSC steps. Rho kinase inhibitor is recommended for passaging and steps where hiPSCs are plated sparsely or as single cells. A) Steps from nucleofection until initial clone picking. Begin by nucleofecting 80% confluent, low passage hiPSCs and conduct puromycin selection. After selection, allow clones to grow before replating cells in a serial dilution at very low density. Then, identify individual cells under a microscope and allow single, monoclonal colonies to grow to 100 cells in rho kinase inhibitor before picking into a 96-well plate. B) Steps from clone picking to positive HDR clone identification. After repicking monoclonal hiPSC colonies into a new 96-well plate, allow the colonies to grow in rho kinase inhibitor before redistributing them within the same well. Then, allow colonies to into 95% confluent monolayers before passaging half into a new plate while simultaneously harvesting half for HDR verification with DNA extraction and PCR/gel electrophoresis. Once positive clones are identified, proceed to C. If no positive clones are identified, re-nucleofect with the same guide RNA or order new guide RNAs. C) Once positive clones are identified, grow the clones in 96-well plates and passage positive clones into 24 and 6-well plates, consecutively. After clones are grown to 6-well plate format, freeze a subset of clones before passaging and expanding for long-term culture.

Article Snippet: Benchling will automatically modify the PAM site in the HDR template so that the selected guide RNA does not self-target the generated HDR template.

Techniques: Subcloning, Passaging, Selection, Clone Assay, Serial Dilution, Microscopy, DNA Extraction, Nucleic Acid Electrophoresis

Journal: Frontiers in Immunology

Article Title: Mutation of the glycine residue preceding the sixth tyrosine of the LAT adaptor severely alters T cell development and activation

doi: 10.3389/fimmu.2022.1054920

Figure Lengend Snippet: Thymic development analysis of LAT G135D mice. (A) Total thymocytes from wild-type (LAT +/+ ), heterozygous (LAT +/G135D ) and homozygous (LAT G135D/G135D ) mutant mice were analyzed for the expression of CD4 and CD8 (upper panels) by flow cytometry. The numbers indicated in each gate represent the percentage of cells. Upper panels show a representative experiment. Lower panels represent bar graphs obtained after the analysis of LAT +/+ (n = 15), LAT +/G135D (n = 9) and LAT G135D/G135D (n = 13) mice, showing the percentages of cells in each of the indicated compartments. The brackets on each bar represent the mean standard error. (B) Dot plots showing CD5 and CD3 expression in DP cells from 6 to 14 weeks old wild-type (LAT +/+ , n = 13), heterozygous (LAT +/G135D , n = 8) and homozygous (LAT G135D/G135D , n = 12) mice. Lower panels represent the quantification of percentages of preselection DP cells (DP1), DP cells undergoing selection (DP2), and post selection DP thymocytes (DP3). * indicates p<0.05; ** indicates p<0.01. (C) Analysis of TCR signaling in thymocytes. 5 x 10 6 fresh thymocytes were obtained from wild-type (LAT +/+ ) and homozygous (LAT G135D/G135D ) mutant mice and incubated with the indicated concentrations of biotin-conjugated anti-CD3 for 30 min, and then stimulated with 10 µg/ml of streptavidin for 3 min at 37°C. Cells were then lysed and analyzed by Western blot with the indicated specific antibodies. Membranes were stripped and reanalyzed with antibodies β-actin to show total protein load. Numbers below the images represent the densitometric quantification of each band.

Article Snippet: The 110 nucleotides-long Lat G135D HDR template (5’-CAGAGCCAGCCTGTAAGAATGTGGATGCAGATGAGGATGAAGACGACTATCCCAACG A CTACCTGTGAGTGGGTAGAGGGGAGGTGACCGTGGAAGTTGTGTGCCCTTTA-3’, the mutated basis is underlined) was synthesized as a ssDNA and purified using polyacrylamide gel electrophoresis (BiOligo, Shanghai, China).

Techniques: Mutagenesis, Expressing, Flow Cytometry, Selection, Incubation, Western Blot

Journal: Frontiers in Immunology

Article Title: Mutation of the glycine residue preceding the sixth tyrosine of the LAT adaptor severely alters T cell development and activation

doi: 10.3389/fimmu.2022.1054920

Figure Lengend Snippet: Peripheral lymphocyte populations are altered by the LAT-G135D mutation. (A) CD4 and CD8 expression was analyzed in splenocytes from wild-type (LAT +/+ ), heterozygous (LAT +/G135D ), and homozygous (LAT G135D/G135D ) mutant mice (upper panels) by flow cytometry. The numbers indicated in each quadrant represent the percentage of cells. Upper panels show a representative experiment. Lower bar graph represents the average of the indicated populations after the analysis of LAT +/+ (n = 14), LAT +/G135D (n = 9), and LAT G135D/G135D (n = 13) mice. The brackets on each bar represent the mean standard error. (B) Dot plots showing CD3 and TCR-γδ expression in splenocytes cells from the indicated types of mice. The bar graph on the right shows the percentages of γδ-T cells in each mouse type: n = 13 for LAT +/+ , n = 9 for LAT +/G135D , and n = 11 for LAT G135D/G135D . (C) Analysis of memory and naive CD4 (upper dot plots) and CD8 (lower dot plots) T cells in spleen from wild-type (LAT +/+ ), heterozygous (LAT +/G135D ), and homozygous (LAT G135D/G135D ) mutant mice. The numbers in the depicted regions represent the percentage of cells.

Article Snippet: The 110 nucleotides-long Lat G135D HDR template (5’-CAGAGCCAGCCTGTAAGAATGTGGATGCAGATGAGGATGAAGACGACTATCCCAACG A CTACCTGTGAGTGGGTAGAGGGGAGGTGACCGTGGAAGTTGTGTGCCCTTTA-3’, the mutated basis is underlined) was synthesized as a ssDNA and purified using polyacrylamide gel electrophoresis (BiOligo, Shanghai, China).

Techniques: Mutagenesis, Expressing, Flow Cytometry

Journal: Frontiers in Immunology

Article Title: Mutation of the glycine residue preceding the sixth tyrosine of the LAT adaptor severely alters T cell development and activation

doi: 10.3389/fimmu.2022.1054920

Figure Lengend Snippet: LAT G135D mutation increases the percentage of anergic T cells. Splenocytes from the indicated types of mice were stained with CD4 and CD25 specific monoclonal antibodies (upper dot plots). The numbers indicated in each gate represent the percentage of CD4 + CD25 - and CD4 + CD25 + cells. Middle panels: CD4 + CD25 - cells were analyzed for the expression of CD73 and FR4, and the percentage of anergic T cells is indicated. Lower bar graphs: average of the indicated populations after the analysis of LAT +/+ (n = 13), LAT +/G135D (n = 8) and LAT G135D/G135D (n = 12) mice. The brackets on each bar represent the mean standard error. * indicates p<0.05.

Article Snippet: The 110 nucleotides-long Lat G135D HDR template (5’-CAGAGCCAGCCTGTAAGAATGTGGATGCAGATGAGGATGAAGACGACTATCCCAACG A CTACCTGTGAGTGGGTAGAGGGGAGGTGACCGTGGAAGTTGTGTGCCCTTTA-3’, the mutated basis is underlined) was synthesized as a ssDNA and purified using polyacrylamide gel electrophoresis (BiOligo, Shanghai, China).

Techniques: Mutagenesis, Staining, Bioprocessing, Expressing

Journal: Frontiers in Immunology

Article Title: Mutation of the glycine residue preceding the sixth tyrosine of the LAT adaptor severely alters T cell development and activation

doi: 10.3389/fimmu.2022.1054920

Figure Lengend Snippet: Ex vivo stimulation assays. (A) T cells purified from the spleens of wild-type LAT (LAT +/+ ) and homozygous (LAT G135D/G135D ) mutant mice were stimulated with the indicated bead:cell ratios of anti-CD3/CD28 microbeads, and analysis of CD69 surface expression 24H post-stimulation was performed on live cells (Annexin V negative). CD69 expression in CD4+ and CD8+ cell populations are shown separately. The numbers indicated in each histogram represent the percentage of CD69 positive cells (red histograms). Blue histograms show CD69 expression in unstimulated cells. One representative experiment is shown (n=3). (B) Analysis of proliferation performed at 72H post-stimulation. Decrease of CTV staining indicates cell proliferation. Blue histograms correspond to unstimulated cells and red histograms to anti-CD3/CD28 stimulated cells. Proliferative capacity was analyzed separately in CD4+ and CD8+ cell populations. The numbers shown in each histogram represent the percentage of cells that have proliferated. One representative experiment is shown (n=3).

Article Snippet: The 110 nucleotides-long Lat G135D HDR template (5’-CAGAGCCAGCCTGTAAGAATGTGGATGCAGATGAGGATGAAGACGACTATCCCAACG A CTACCTGTGAGTGGGTAGAGGGGAGGTGACCGTGGAAGTTGTGTGCCCTTTA-3’, the mutated basis is underlined) was synthesized as a ssDNA and purified using polyacrylamide gel electrophoresis (BiOligo, Shanghai, China).

Techniques: Ex Vivo, Purification, Mutagenesis, Expressing, Staining